WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00056632 Gene Name  CRE09157
Sequence Name  ? CRE09157 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Protein of unknown function (DUF1647) and Protein of unknown function DUF1647. Is an ortholog of C. elegans F41D3.9; T15D6.9; and ZK1053.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE09157.1 CRE09157.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE09157 CRE09157   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE09157, TTTCGAATTCCGACAATTCAATACTGCTCAATATCCGGAATATGTCAGTCAATGGTTGCA, WBGene00056632   Expr1104645 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term