WormMine: Gene WBGene00056664

• WormBase Gene ID: WBGene00056664
• Gene Name: CRE08746
• Sequence Name: CRE08746
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Etoposide-induced 2.4 and Etoposide-induced protein 2.4 (EI24). Is an ortholog of C. elegans epg-4. In C. elegans, epg-4 is involved in macroautophagy and negative regulation of autophagosome assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE08746.1	CRE08746.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE08746	CRE08746		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113965
• Remark: CRE08746, ATTCCCCTCATTAAGCCATTCATTTTTTTCGTCCACATGTCTCTTCTCAACTCAATGTAT, WBGene00056664
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term