WormMine: Gene WBGene00056228

• WormBase Gene ID: WBGene00056228
• Gene Name: Cre-rpn-10
• Sequence Name: CRE28169
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: von Willebrand factor type A domain; Proteasome subunit Rpn10; Ubiquitin interacting motif; von Willebrand factor A-like domain superfamily; von Willebrand factor, type A; and Ubiquitin interaction motif. Is an ortholog of C. elegans rpn-10. In C. elegans, rpn-10 is involved in spermatogenesis and ubiquitin-dependent protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE28169.1	CRE28169.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE28169	CRE28169		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111787
• Remark: Cre-rpn-10, GGAAATCTTGATGATTTGTTGAACAACCCAGAGCTCCTTCAGCAAATTGTGGATGATTTG, WBGene00056228
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term