WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128542 Gene Name  Cjp-nyn-2
Sequence Name  ? CJA09337 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Zc3h12a-like Ribonuclease NYN domain. Is an ortholog of C. elegans nyn-2. In C. elegans, nyn-2 is involved in siRNA processing. Biotype  SO:0001217
Genetic Position 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09337.1 CJA09337.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09337 CJA09337   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA09337, TCAAATCCGTCTCATCTGCGAACTTTGCCAACTCTACCCGATGAAATCACTTCATAAAGT, WBGene00128542   Expr1081860 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term