WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00125119 Gene Name  Cjp-ham-3
Sequence Name  ? CJA05915 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: SWIB domain; SWIB/MDM2 domain superfamily; and SWIB/MDM2 domain. Is an ortholog of C. elegans ham-3. In C. elegans, ham-3 is involved in determination of adult lifespan; negative regulation of transcription by RNA polymerase II; and positive regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA05915.1 CJA05915.1   [unknown]
Transcript:CJA05915.2 CJA05915.2   [unknown]
Transcript:CJA05915.3 CJA05915.3   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA05915 CJA05915   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-tag-246, ACAGTTTTATCAAGAAATGGGTGGTCAGTCAGAATGCTGATTTGAAGACGTTGACGGAGA, WBGene00125119   Expr1075427 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term