WormMine: Gene WBGene00032586

• WormBase Gene ID: WBGene00032586
• Gene Name: Cbr-sel-10
• Sequence Name: CBG11475
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; F-box-like; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; F-box-like domain superfamily; F-box domain; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans sel-10. In C. elegans, sel-10 is involved in several processes, including negative regulation of Notch signaling pathway; negative regulation of centrosome duplication; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11475b.1	CBG11475b.1		[unknown]
Transcript:CBG11475a.1	CBG11475a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11475a	CBG11475a		[unknown]
CDS:CBG11475b	CBG11475b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059993
• Remark: Cbr-sel-10, GATAGCGTTTCTATCAGGACACACTTCATTGACATCTGGCATGCAGCTGAGAGGAAACAT, WBGene00032586
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term