WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032607 Gene Name  Cbr-dct-17
Sequence Name  ? CBG11497 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans dct-17. In C. elegans, dct-17 is involved in defense response to Gram-negative bacterium and innate immune response. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11497a.1 CBG11497a.1   [unknown]
Transcript:CBG11497c.1 CBG11497c.1   [unknown]
Transcript:CBG11497b.1 CBG11497b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11497a CBG11497a   [unknown]
CDS:CBG11497b CBG11497b   [unknown]
CDS:CBG11497c CBG11497c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dct-17, AATGATGGAGATGAATTAGATGTTGAAGTTGGATCAGTTAATGGACTCACTACTTTGGAA, WBGene00032607   Expr1059087 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term