WormMine: Gene WBGene00032607

• WormBase Gene ID: WBGene00032607
• Gene Name: Cbr-dct-17
• Sequence Name: CBG11497
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans dct-17. In C. elegans, dct-17 is involved in defense response to Gram-negative bacterium and innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11497a.1	CBG11497a.1		[unknown]
Transcript:CBG11497c.1	CBG11497c.1		[unknown]
Transcript:CBG11497b.1	CBG11497b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11497a	CBG11497a		[unknown]
CDS:CBG11497b	CBG11497b		[unknown]
CDS:CBG11497c	CBG11497c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059087
• Remark: Cbr-dct-17, AATGATGGAGATGAATTAGATGTTGAAGTTGGATCAGTTAATGGACTCACTACTTTGGAA, WBGene00032607
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term