WormMine: Gene WBGene00070180

• WormBase Gene ID: WBGene00070180
• Gene Name: Cre-elks-1
• Sequence Name: CRE01335
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: RIM-binding protein of the cytomatrix active zone and Active zone protein ELKS. Is an ortholog of C. elegans elks-1. In C. elegans, elks-1 is involved in protein localization and regulation of protein deneddylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01335.1	CRE01335.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01335	CRE01335		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104049
• Remark: Cre-elks-1, GGAGAGTCAAAATGAGAAGATTGGAGATATGAGTCGGGATTTGTCCACGGCGAAGAAACG, WBGene00070180
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term