WormMine: Gene WBGene00058258

• WormBase Gene ID: WBGene00058258
• Gene Name: Cre-ftt-2
• Sequence Name: CRE07514
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: 14-3-3 protein; 14-3-3 domain superfamily; and 14-3-3 domain. Is an ortholog of C. elegans ftt-2. In C. elegans, ftt-2 is involved in cytoplasmic sequestering of protein; dauer larval development; and negative regulation of protein import into nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07514.1	CRE07514.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07514	CRE07514		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112129
• Remark: Cre-ftt-2, CGGTTGTCGAGAAGTCGCAGCAAAGCTATCAAGAGGCGTTCGACATCGCCAAGGATAAGA, WBGene00058258
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term