WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00058302 Gene Name  Cre-aco-1
Sequence Name  ? CRE07301 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Aconitase C-terminal domain; Aconitase A/isopropylmalate dehydratase small subunit, swivel domain; Aconitase family (aconitate hydratase); Aconitase/Iron-responsive element-binding protein 2; Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3; Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha domain; Aconitase/3-isopropylmalate dehydratase, swivel; and Aconitase, iron-sulfur domain. Is an ortholog of C. elegans aco-1. In C. elegans, aco-1 is involved in tricarboxylic acid metabolic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE07301.1 CRE07301.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE07301 CRE07301   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-aco-1, AACTCACCTACTACCGCAACGGAGGAATTCTTCAGTACATGATCAGGAAATTGATTCAGT, WBGene00058302   Expr1094779 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term