WormMine: Gene WBGene00124228

• WormBase Gene ID: WBGene00124228
• Gene Name: Cjp-phf-30
• Sequence Name: CJA05024
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: PHD-finger; Zinc finger, PHD-type; Zinc finger, PHD-finger; Zinc finger, RING/FYVE/PHD-type; and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans phf-30.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05024.1	CJA05024.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05024	CJA05024		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083535
• Remark: CJA05024, CAGCCGTGCTCCACGTGTCAAGGCGTTTCACAGGCCGGCAATCAAGTATTAATATGCAAA, WBGene00124228
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term