WormMine: Gene WBGene00058663

• WormBase Gene ID: WBGene00058663
• Gene Name: Cre-olrn-1
• Sequence Name: CRE15368
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Nucleoside 2-deoxyribosyltransferase-like and Nucleoside 2-deoxyribosyltransferase like. Is an ortholog of C. elegans olrn-1. In C. elegans, olrn-1 is involved in olfactory learning.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15368.1	CRE15368.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15368	CRE15368		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104137
• Remark: Cre-olrn-1, CTGGATAGCCGCATGAATTGCCTCAGGACTTGGTTCCATCATCATAAAAAATTCTTCTAC, WBGene00058663
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term