WormMine: Gene WBGene00058532

• WormBase Gene ID: WBGene00058532
• Gene Name: Cre-syg-2
• Sequence Name: CRE15300
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin; Immunoglobulin I-set; Immunoglobulin subtype; Fibronectin type III; Immunoglobulin-like fold; Immunoglobulin domain; CD80-like C2-set immunoglobulin domain; CD80-like, immunoglobulin C2-set; Immunoglobulin subtype 2; Fibronectin type III domain; Immunoglobulin-like domain superfamily; and Fibronectin type III superfamily. Is an ortholog of C. elegans syg-2. In C. elegans, syg-2 is involved in cell-cell signaling; nervous system development; and protein localization to synapse.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15300.1	CRE15300.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15300	CRE15300		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1099351
• Remark: Cre-syg-2, ACTGAAATGGCGAGAACAGCAATTAACGGCGGCGACGTGCGGCAAGTTCAAATGTACGGA, WBGene00058532
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term