WormMine: Gene WBGene00057056

• WormBase Gene ID: WBGene00057056
• Gene Name: Cre-kri-1
• Sequence Name: CRE30088
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ankyrin repeat; KRIT, N-terminal NPxY motif-rich region; FERM superfamily, second domain; Domain of unknown function DUF3447; NUDIX, or N-terminal NPxY motif-rich, region of KRIT; Ankyrin repeat-containing domain superfamily; FERM central domain; Ankyrin repeats (3 copies); and PH-like domain superfamily. Is an ortholog of C. elegans kri-1. In C. elegans, kri-1 is involved in positive regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30088.1	CRE30088.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30088	CRE30088		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103909
• Remark: Cre-kri-1, TCCAGAAGATGCAACAGCAAGCGAAGTGTTGGATATCTTGGGAGAGGAGACACAGTTGAA, WBGene00057056
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term