WormMine: Gene WBGene00057551

• WormBase Gene ID: WBGene00057551
• Gene Name: Cre-ing-3
• Sequence Name: CRE11675
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Inhibitor of growth proteins N-terminal histone-binding; Inhibitor of growth protein, N-terminal histone-binding; Zinc finger, PHD-type; Zinc finger, RING/FYVE/PHD-type; Inhibitor of growth protein 3; and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans ing-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11675.1	CRE11675.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11675	CRE11675		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1099128
• Remark: Cre-ing-3, TGGATCGGATGATGAGGACGAAGAAGATGCCAGAAACTGGTGTTTTTGCAACGAAAAGAG, WBGene00057551
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term