WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00057463 Gene Name  CRE11888
Sequence Name  ? CRE11888 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Caenorhabditis elegans protein of unknown function (DUF780) and Protein of unknown function DUF780, Caenorhabditis species. Is an ortholog of C. elegans nspd-8; nspd-4; and nspd-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE11888.1 CRE11888.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE11888 CRE11888   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:activated_sperm_CRE
  Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:membranous_oraganelle_CRE
  Proteins expressed in unactivated C. remanei spermatids. N.A WBPaper00054996:unactivated_spermatid_CRE

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE11888, TCGTGAAGACTACGCATCAGGAGGAAGCGGTGGTGGAGCCAGCAACAACAACAATCAAGG, WBGene00057463   Expr1110367 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term