WormMine: Gene WBGene00057311

• WormBase Gene ID: WBGene00057311
• Gene Name: Cre-mdt-26
• Sequence Name: CRE11808
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: TFIIS/LEDGF domain superfamily; Transcription factor IIS, N-terminal; and TFIIS helical bundle-like domain. Is an ortholog of C. elegans mdt-26.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11808.1	CRE11808.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11808	CRE11808		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097980
• Remark: Cre-mdt-26, TCCAAATAGTCTACAGTACTACTCGGAAGACAATTTTAGGTTTGGAGAGAAGCGCCCCAC, WBGene00057311
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term