WormMine: Gene WBGene00068333

• WormBase Gene ID: WBGene00068333
• Gene Name: CRE30393
• Sequence Name: CRE30393
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Family of unknown function (DUF5346) and Protein of unknown function DUF5346. Is an ortholog of C. elegans D2096.6. In C. elegans, D2096.6 is involved in endoplasmic reticulum unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30393.1	CRE30393.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30393	CRE30393		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105631
• Remark: CRE30393, CAACTTCCCGATGGAATTTCCTCCTCGATCAACTCATGGGTTCAACGTCAAAAGTTGTAA, WBGene00068333
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term