WormMine: Gene WBGene00065299

• WormBase Gene ID: WBGene00065299
• Gene Name: Cre-aakb-1
• Sequence Name: CRE22321
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin E-set; AMP-activated protein kinase, glycogen-binding domain; 5'-AMP-activated protein kinase beta subunit, interaction domain; ASC domain superfamily; Immunoglobulin-like fold; Association with the SNF1 complex (ASC) domain; and Glycogen recognition site of AMP-activated protein kinase. Is an ortholog of C. elegans aakb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE22321.1	CRE22321.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE22321	CRE22321		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106250
• Remark: Cre-aakb-1, CTCAGCAACCCACCGCTACCGAAAGAAGTTTGTGACCACTTTACTCTACAAACCAATCTA, WBGene00065299
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term