WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039824 Gene Name  Cbr-pqn-87
Sequence Name  ? CBG20921 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: TRAF-like; MATH/TRAF domain; and MATH domain. Is an ortholog of C. elegans pqn-87. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

7 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG20921e.1 CBG20921e.1   [unknown]
Transcript:CBG20921f.1 CBG20921f.1   [unknown]
Transcript:CBG20921g.1 CBG20921g.1   [unknown]
Transcript:CBG20921a.1 CBG20921a.1   [unknown]
Transcript:CBG20921b.1 CBG20921b.1   [unknown]
Transcript:CBG20921d.1 CBG20921d.1   [unknown]
Transcript:CBG20921c.1 CBG20921c.1   [unknown]
 

Other

7 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG20921g CBG20921g   [unknown]
CDS:CBG20921f CBG20921f   [unknown]
CDS:CBG20921c CBG20921c   [unknown]
CDS:CBG20921b CBG20921b   [unknown]
CDS:CBG20921e CBG20921e   [unknown]
CDS:CBG20921d CBG20921d   [unknown]
CDS:CBG20921a CBG20921a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-pqn-87, AACAACGGGTGCAACAACAGCAGCCACGTGGTTATGGTGATATGTGGAATGCTCAAACCA, WBGene00039824   Expr1052327 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term