WormMine: Gene WBGene00059722

• WormBase Gene ID: WBGene00059722
• Gene Name: Cre-tra-4
• Sequence Name: CRE09624
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger C2H2-type and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans tra-4. In C. elegans, tra-4 is involved in hermaphrodite somatic sex determination; negative regulation of vulval development; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE09624.1	CRE09624.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE09624	CRE09624		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096629
• Remark: Cre-tra-4, GATGACCCACGAGAGAGTCCACACGGGAATCATCAAGTTCGAATGTAAGGTCTGCGACTT, WBGene00059722
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term