WormMine: Gene WBGene00024120

• WormBase Gene ID: WBGene00024120
• Gene Name: CBG00786
• Sequence Name: CBG00786
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Zinc finger C2H2-type. Is an ortholog of C. elegans lsy-27; ztf-25; and ztf-28. In C. elegans, lsy-27 is involved in neuron differentiation and regulation of DNA-templated transcription.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00786.1	CBG00786.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00786	CBG00786		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056441
• Remark: Cbr-ztf-28, AAAAAGTCCGACTTGTTGGAGCATACCAAGGCCATGAACGAGACTGGAACTGTAGGAGAT, WBGene00024120
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term