WormBase Gene ID
|
WBGene00059979 | Gene Name | CRE29770 |
| Sequence Name
|
CRE29770 | Organism | Caenorhabditis remanei |
| Automated Description | Is predicted to encode a protein with the following domains: N-terminal region of Chorein or VPS13; Vacuolar protein sorting-associated protein 13, SHR-binding domain; Vacuolar protein sorting-associated protein 13; Vacuolar protein sorting-associated protein 13-like, N-terminal domain; SHR-binding domain of vacuolar-sorting associated protein 13; Vacuolar protein sorting-associated protein 13, C-terminal; Vacuolar sorting-associated protein 13, N-terminal; VPS13, repeated coiled region; Vacuolar protein sorting-associated protein 13, second N-terminal domain; Vacuolar-sorting-associated 13 protein C-terminal; and Repeating coiled region of VPS13. Is an ortholog of C. elegans T08G11.1. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE29770.1 | CRE29770.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CRE29770, TTAATCGTAAACCACAATCATTCGGAGAAGGAATGGCACGTGGATTGAAGGGACTCGGAA, WBGene00059979 | Expr1110987 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
