WormMine: Gene WBGene00059861

• WormBase Gene ID: WBGene00059861
• Gene Name: Cre-pdpr-1
• Sequence Name: CRE29621
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: FAD/NAD(P)-binding domain superfamily; FAD dependent oxidoreductase; GTP-binding protein TrmE/Aminomethyltransferase GcvT, domain 1; FAD dependent oxidoreductase central domain; Aminomethyltransferase folate-binding domain; Glycine cleavage T-protein/YgfZ, C-terminal; Glycine cleavage T-protein C-terminal barrel domain; FAD dependent oxidoreductase, central domain; Glycine cleavage T-protein, C-terminal barrel domain; and Aminomethyltransferase, folate-binding domain. Is an ortholog of C. elegans pdpr-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29621.1	CRE29621.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29621	CRE29621		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097925
• Remark: CRE29621, GCCAGTGAGTACGAAGCATGTAGAGAACGAGTTGGACTTATGGATATGAGTAGCTTCAGC, WBGene00059861
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term