WormMine: Gene WBGene00085581

• WormBase Gene ID: WBGene00085581
• Gene Name: Cre-vha-19
• Sequence Name: CRE11539
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: V-type proton ATPase subunit S1, luminal domain and V0 complex accessory subunit Ac45. Is an ortholog of C. elegans vha-19. In C. elegans, vha-19 is involved in intracellular water homeostasis; positive regulation of oocyte development; and positive regulation of protein targeting to membrane.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11539.1	CRE11539.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11539	CRE11539		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111803
• Remark: Cre-vha-19, CCAATCGGTTCAGACGATGGATAGATTCGATGATCCGAAACAGAAGCAGATTGTTATCAA, WBGene00085581
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term