WormMine: Gene WBGene00032952

• WormBase Gene ID: WBGene00032952
• Gene Name: Cbr-sol-1
• Sequence Name: CBG11922
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: CUB domain and Spermadhesin, CUB domain superfamily. Is an ortholog of C. elegans sol-1. In C. elegans, sol-1 is involved in several processes, including hyperosmotic response; positive regulation of glutamatergic synaptic transmission; and thigmotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11922c.1	CBG11922c.1		[unknown]
Transcript:CBG11922b.1	CBG11922b.1		[unknown]
Transcript:CBG11922a.1	CBG11922a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11922c	CBG11922c		[unknown]
CDS:CBG11922b	CBG11922b		[unknown]
CDS:CBG11922a	CBG11922a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065009
• Remark: Cbr-sol-1, AACGAACGACATCTTCGATGCAACTGGATTCTATGCTCATTATCAGTTTATCACTCAAGA, WBGene00032952
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term