WormMine: Gene WBGene00032977

• WormBase Gene ID: WBGene00032977
• Gene Name: Cbr-mce-1
• Sequence Name: CBG11959
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase; Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; and Methylmalonyl-CoA epimerase. Is an ortholog of C. elegans mce-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11959b.1	CBG11959b.1		[unknown]
Transcript:CBG11959a.1	CBG11959a.1		[unknown]
Transcript:CBG11959a.2	CBG11959a.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11959b	CBG11959b		[unknown]
CDS:CBG11959a	CBG11959a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061452
• Remark: Cbr-mce-1, AAAGATTGGAGCTCACGGAAAACCAGTCATGTTCTTGCATCCAAAGGATTGTGGAGGTGT, WBGene00032977
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term