WormMine: Gene WBGene00270573

• WormBase Gene ID: WBGene00270573
• Gene Name: CBG30421
• Sequence Name: CBG30421
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Carboxylesterase family; Carboxylesterase, type B; and Alpha/Beta hydrolase fold. Is an ortholog of C. elegans cest-5.1 and cest-5.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG30421.1	CBG30421.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG30421	CBG30421		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054328
• Remark: CBG05395, AGAAATTTGTATATTAGAATTGATGGAGCAAACTTTAGGAAAAACCCAGAATTTTTTAAC, WBGene00027851
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term