WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00127547 Gene Name  CJA08344
Sequence Name  ? CJA08344 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: von Willebrand factor, type A; von Willebrand factor type A domain; and von Willebrand factor A-like domain superfamily. Is an ortholog of C. elegans T19D12.4. In C. elegans, T19D12.4 is involved in defense response to Gram-negative bacterium and innate immune response. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA08344b.1 CJA08344b.1   [unknown]
Transcript:CJA08344a.1 CJA08344a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA08344a CJA08344a   [unknown]
CDS:CJA08344b CJA08344b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA08344, AAGACTACGTTTTCATGAACTACATCACCAAACTCCTCGCTCAATTCTCAGCACAAGACG, WBGene00127547   Expr1091894 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term