WormMine: Gene WBGene00060412

• WormBase Gene ID: WBGene00060412
• Gene Name: Cre-rps-10
• Sequence Name: CRE03862
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Plectin/S10, N-terminal; Plectin/S10 domain; 40S Ribosomal protein S10; and Winged helix-like DNA-binding domain superfamily. Is an ortholog of C. elegans rps-10. In C. elegans, rps-10 is involved in determination of adult lifespan.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03862a.1	CRE03862a.1		[unknown]
Transcript:CRE03862b.1	CRE03862b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03862a	CRE03862a		[unknown]
CDS:CRE03862b	CRE03862b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1112132
• Remark: Cre-rps-10, CTGTCGCCAAGAAAGACTTCAATGCCAAGACTCACCCAAATATCGATGGAGTTTCCAACC, WBGene00060412
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term