WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00271717 Gene Name  CBG31044
Sequence Name  ? CBG31044 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: HORMA domain superfamily and HORMA domain. Is an ortholog of C. elegans htp-1 and htp-2. In C. elegans, htp-1 is involved in regulation of centriole-centriole cohesion. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG31044.1 CBG31044.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG31044 CBG31044   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG20864, AGCCGGGAATCGTCTTCAGCTTCGATGAATTCCACTCAGAAGAACAGCTCGAATAACAAG, WBGene00039775   Expr1050708 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term