WormMine: Gene WBGene00028023

• WormBase Gene ID: WBGene00028023
• Gene Name: CBG05609
• Sequence Name: CBG05609
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Tapt1 family and Eukaryotic membrane protein family. Is an ortholog of C. elegans F26F2.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05609a.1	CBG05609a.1		[unknown]
Transcript:CBG05609c.1	CBG05609c.1		[unknown]
Transcript:CBG05609b.1	CBG05609b.1		[unknown]
Transcript:CBG05609d.1	CBG05609d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05609c	CBG05609c		[unknown]
CDS:CBG05609b	CBG05609b		[unknown]
CDS:CBG05609d	CBG05609d		[unknown]
CDS:CBG05609a	CBG05609a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054148
• Remark: CBG05609, ATTATGATCATTCGAGTGTTGAGTCAGACGTTTACACTCGATAATTGGGGATCGATTATT, WBGene00028023
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term