WormMine: Gene WBGene00039256

• WormBase Gene ID: WBGene00039256
• Gene Name: Cbr-nrde-2
• Sequence Name: CBG20217
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: siRNA-mediated silencing protein NRDE-2 and NRDE-2, necessary for RNA interference. Is an ortholog of C. elegans nrde-2. In C. elegans, nrde-2 is involved in regulatory ncRNA-mediated heterochromatin formation and regulatory ncRNA-mediated post-transcriptional gene silencing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20217.1	CBG20217.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20217	CBG20217		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051550
• Remark: CBG20217, AAGCAGAAGGATTGGAATCGAGGAGACACGGAGAAATACAGGGATCGAGTGGATATTCAG, WBGene00039256
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term