WormMine: Gene WBGene00081923

• WormBase Gene ID: WBGene00081923
• Gene Name: Cre-mlt-2
• Sequence Name: CRE07848
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; Ankyrin repeats (3 copies); and Ankyrin repeat. Is an ortholog of C. elegans mlt-2. In C. elegans, mlt-2 is involved in ecdysis, collagen and cuticulin-based cuticle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07848.1	CRE07848.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07848	CRE07848		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113451
• Remark: CRE07848, CTCAACATCTACACACCAGAGAATATGGCAGTGATTGAAGAGATTCAGCAGATGTACCCT, WBGene00081923
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term