WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00131697 Gene Name  CJA12493
Sequence Name  ? CJA12493 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Immunoglobulin E-set; Immunoglobulin-like fold; Filamin/ABP280 repeat-like; and Filamin/ABP280 repeat. Is an ortholog of C. elegans fln-1. In C. elegans, fln-1 is involved in several processes, including axon development; semaphorin-plexin signaling pathway; and uterus morphogenesis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12493.1 CJA12493.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12493 CJA12493   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA12493, AAAACGCGCCAACCGACTTGACCTACCTCCATCCATCCGAGGGAAGCAAGAAGAAAAAGG, WBGene00131697   Expr1073418 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA04061, GAAAATAAATGCTGATGGAACGTACTCCACGGACACGCCGCTTCTTCAGCCAGGAAAGCA, WBGene00123265   Expr1072786 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term