WormMine: Gene WBGene00028155

• WormBase Gene ID: WBGene00028155
• Gene Name: Cbr-rde-8
• Sequence Name: CBG05767
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zc3h12a-like Ribonuclease NYN domain and Ribonuclease Zc3h12a-like, NYN domain. Is an ortholog of C. elegans rde-8. In C. elegans, rde-8 is involved in siRNA processing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05767b.1	CBG05767b.1		[unknown]
Transcript:CBG05767a.1	CBG05767a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05767b	CBG05767b		[unknown]
CDS:CBG05767a	CBG05767a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055206
• Remark: CBG05767, AGTTGTTCTCACTTCCGATTTATATCGAGATCACTCAAATATGAATAATCGATCACGTCG, WBGene00028155
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term