WormMine: Gene WBGene00070986

• WormBase Gene ID: WBGene00070986
• Gene Name: Cre-mes-2.2
• Sequence Name: CRE14322
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: SET domain; Pre-SET CXC domain; and CXC domain. Is an ortholog of C. elegans mes-2. In C. elegans, mes-2 is involved in epigenetic regulation of gene expression; germ-line stem cell division; and tissue development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14322.1	CRE14322.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14322	CRE14322		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114457
• Remark: CRE14322, GGAGTACCTTTGTCCAGTTCACGGGCTTCGTCTCCAGATTGCACCGGAGATTCCAGGTGG, WBGene00070986
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term