WormMine: Gene WBGene00036888

• WormBase Gene ID: WBGene00036888
• Gene Name: CBG17169
• Sequence Name: CBG17169
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Cysteine-rich secretory protein family; CAP superfamily; CAP domain; and Cysteine-rich secretory protein-related. Is an ortholog of C. elegans C07A4.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17169.1	CBG17169.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17169	CBG17169		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059672
• Remark: CBG17169, ATGATCCTGCTGGAAATATGGAGTCTCATAAGGCATATTTGAACAACGTGAAACGACCTG, WBGene00036888
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term