WormMine: Gene WBGene00068883

• WormBase Gene ID: WBGene00068883
• Gene Name: Cre-alkb-1
• Sequence Name: CRE14334
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Alkylated DNA repair protein AlkB; Alpha-ketoglutarate-dependent dioxygenase AlkB-like superfamily; 2OG-Fe(II) oxygenase superfamily; and Alpha-ketoglutarate-dependent dioxygenase AlkB-like. Is an ortholog of C. elegans alkb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14334.1	CRE14334.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14334	CRE14334		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092736
• Remark: CRE14334, ATCCGAACGCTCGAACGCGCCGCTCATCTCAATGTCACTCGGCCAATCAGCAGTCTATCT, WBGene00068883
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term