WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028301 Gene Name  CBG05945
Sequence Name  ? CBG05945 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-htz-1 based on RNA-seq studies. Is an ortholog of C. elegans F33D4.6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05945c.1 CBG05945c.1   [unknown]
Transcript:CBG05945a.1 CBG05945a.1   [unknown]
Transcript:CBG05945b.1 CBG05945b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05945c CBG05945c   [unknown]
CDS:CBG05945a CBG05945a   [unknown]
CDS:CBG05945b CBG05945b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG05945, CACTGTTGAGGAATTCGCCAAGGAACACTGCTATTTCATCGAAAACTACTATCCAGCTCT, WBGene00028301   Expr1052405 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term