WormMine: Gene WBGene00031406

• WormBase Gene ID: WBGene00031406
• Gene Name: CBG09895
• Sequence Name: CBG09895
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Exportin-1/Importin-beta-like; Armadillo-type fold; Exportin 1-like protein; and Armadillo-like helical. Is an ortholog of C. elegans T16G12.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09895b.1	CBG09895b.1		[unknown]
Transcript:CBG09895a.1	CBG09895a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09895a	CBG09895a		[unknown]
CDS:CBG09895b	CBG09895b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061724
• Remark: CBG09895, GATCGTCTGCTCTGATCACAGCAATGTTCCGAGAAATTGGTAACCTGCGTAATTTCAAGC, WBGene00031406
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term