WormMine: Gene WBGene00061838

• WormBase Gene ID: WBGene00061838
• Gene Name: Cre-vms-1
• Sequence Name: CRE24512
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Vms1-associating treble clef domain; Bacteroidetes VLRF1 release factor; and VLRF1/Vms1. Is an ortholog of C. elegans vms-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24512.1	CRE24512.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24512	CRE24512		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092993
• Remark: CRE24512, AATATGTGAAAATGAGTGAAAGAGAGAAACGGGCGATGGCAGTGGACAGACGGCTTGCTG, WBGene00061838
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term