WormMine: Gene WBGene00060240

• WormBase Gene ID: WBGene00060240
• Gene Name: Cre-aex-3
• Sequence Name: CRE17111
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: dDENN domain; cDENN domain; uDENN domain; MAP kinase-activating death domain protein; and DENN (AEX-3) domain. Is an ortholog of C. elegans aex-3. In C. elegans, aex-3 is involved in several processes, including egg-laying behavior; mating; and positive regulation of digestive system process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17111.1	CRE17111.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17111	CRE17111		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100775
• Remark: Cre-aex-3, GTTGTGATGGTGTTGCAGTTATATTTGCTCACAGTCAGATATTTATTGGTCTCTCTAATA, WBGene00060240
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term