WormMine: Gene WBGene00121090

• WormBase Gene ID: WBGene00121090
• Gene Name: CJA01886
• Sequence Name: CJA01886
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Receptor, ligand binding region; Receptor family ligand binding region; and Periplasmic binding protein-like I. Is an ortholog of C. elegans gcy-23. In C. elegans, gcy-23 is involved in detection of temperature stimulus; thermosensory behavior; and thermotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01886.1	CJA01886.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01886	CJA01886		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090608
• Remark: Cjp-gcy-23, GAGGTTTTTCATACTCGAGGTGTGACTCTTGTCAAGAAAATCATGTTGGATGAGTATACA, WBGene00121090
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term