WormMine: Gene WBGene00121713

• WormBase Gene ID: WBGene00121713
• Gene Name: CJA02509
• Sequence Name: CJA02509
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Asparaginase/glutaminase-like; Ankyrin repeat; Domain of unknown function DUF3447; Asparaginase/glutaminase-like superfamily; Asparaginase/glutaminase, C-terminal; Glutaminase/Asparaginase C-terminal domain; L-asparaginase, C-terminal; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans C27A7.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02509.1	CJA02509.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02509	CJA02509		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082629
• Remark: CJA17307, TTGCCGCTTCCAATGGAAACATTGAGGCTGTCAATTACTTGCTCAAAATTGGAGTTAATG, WBGene00136511
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term