WormMine: Gene WBGene00036465

• WormBase Gene ID: WBGene00036465
• Gene Name: Cbr-odr-4
• Sequence Name: CBG16563
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: ODR-4-like and Odorant response abnormal 4-like. Is an ortholog of C. elegans odr-4. In C. elegans, odr-4 is involved in olfactory behavior; receptor localization to non-motile cilium; and response to odorant.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16563.1	CBG16563.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16563	CBG16563		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067454
• Remark: Cbr-odr-4, CCGCTATTCTGATCAATGATTTCCTCTTTGAAGCCGATAACGTTGAAGACGCGCAAAAGA, WBGene00036465
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term