WormMine: Gene WBGene00120316

• WormBase Gene ID: WBGene00120316
• Gene Name: CJA01112
• Sequence Name: CJA01112
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function (DUF1280) and Protein of unknown function DUF1280. Is an ortholog of C. elegans T07F8.1 and ZK686.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01112.1	CJA01112.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01112	CJA01112		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085318
• Remark: CJA01112, CTTCATTACCGATTTCGTTAACTTCGTGGCGAATTGTGACTCATATAAATTTTCCTTCAA, WBGene00120316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term