WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120310 Gene Name  CJA01105
Sequence Name  ? CJA01105 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Ribosomal L28e protein family; Mak16 protein C-terminal region; Ribosomal L28e/Mak16; and Mak16 protein. Is an ortholog of C. elegans C16A3.6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01105.1 CJA01105.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01105 CJA01105   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA01105, AAAGTGGAAAGACGTGAGAAGCGTCGCGAGGAGAAGGCGTTGGTGGCTGCTAAACTGGAT, WBGene00120310   Expr1073004 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term