WormMine: Gene WBGene00120249

• WormBase Gene ID: WBGene00120249
• Gene Name: CJA01045
• Sequence Name: CJA01045
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Latrophilin-1; GAIN domain, N-terminal; and GPCR-Autoproteolysis INducing (GAIN) domain. Is an ortholog of C. elegans lat-2. In C. elegans, lat-2 is involved in self proteolysis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01045.1	CJA01045.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01045	CJA01045		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086251
• Remark: Cjp-lat-2, AACATCTTACGACGAAAGGCGTGTCGAATGCGCGGTGTGTTTATTGGGATTTGACGGAAA, WBGene00120249
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term