WormMine: Gene WBGene00120196

• WormBase Gene ID: WBGene00120196
• Gene Name: CJA00992
• Sequence Name: CJA00992
• Organism: Caenorhabditis japonica
• Automated Description: Is an ortholog of C. elegans kin-18. In C. elegans, kin-18 is involved in feeding behavior; regulation of meiosis I; and regulation of nematode pharyngeal pumping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00992c.1	CJA00992c.1		[unknown]
Transcript:CJA00992a.1	CJA00992a.1		[unknown]
Transcript:CJA00992b.1	CJA00992b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00992a	CJA00992a		[unknown]
CDS:CJA00992b	CJA00992b		[unknown]
CDS:CJA00992c	CJA00992c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082190
• Remark: CJA00992, AGGACAAAACGGTGAAATTGGAGTCGTGGCAGGAAGACGAGCAGCGTGTTTTGAGCGAAA, WBGene00120196
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term